Archaeorhizomyces finlayi

The Archaeorhizomycetes are a newly described class of 2011 of the Ascomycota with the moment of a type described ( Archaeorhizomyces finlayi ), at least 100 different so-called "operational taxonomic units" ( OTUs ).

Features

They differ from the sister class of Taphrinomycetes by their growth on modified Melin Norkans agar ( MMN ) and its association with the roots of living plants. Molecular genetic table the class by the ( AACAAGTAG ) positions of the 60s subunit and the (T) position of the 40S subunit is distinguished relative to Saccharomyces cerevisiae.

The genus is characterized by creamy-white colonies on MMN agar, which grow slowly and have a feathery. Molecular genetic the class by the (A) position of the 5.8S rDNA and the ( GCATATCAATAAGGYGAGGA ) positions of the 40S subunit, the binding site of primer ITS4 is differentiated with respect to Saccharomyces cerevisiae.

The type species Archaeorhizomyces finlayi forms colonies on MMN medium with only a few aerial hyphae and a feathery edge and was isolated from a mycorrhizal root tip from a mixed conifer forest. The mycelium is composed of 1 to 2 microns thin hyphae with simple non-porous septa. At the age 3 to 6 microns large chlamydospores with up to four upright hyphae are formed. Molecular genetic table has the following type ITS properties: ( TTTGGCGCCCGGTCTATGCC )

Ecology and distribution

The Archaeorhizomycetes live on plant roots and in the rhizosphere and are cosmopolitan spread. Archaeorhizomyces finlayi has been isolated from Scandinavia and North America. You are probably present in many terrestrial ecosystems. About their lifestyle is still very little known. Initially it was assumed that they refer all the carbon from the plant root. However, they do not form known Mykorrhizastruktur. In addition, they can also grow on nutrient media containing cellulose and glucose as the sole carbon source. This indicates that they may be involved at least in the decomposition of organic matter and do not refer all the carbon from the plant through symbiosis.

System

The Archaeorhizomycetes are a class within the Taphrinomycotina and are at the base of the phylogenetic tree of the Ascomycota.

Etymology

ἀρχαῖος archaios means old, ancient, which refers to the basal position within the Ascomycota. ῥιζο rhiza refers to root, and μύκης mykes called fungus. The epithet finlayi honors the Swedish mycologist Roger D. Finlay.

Swell

• Anna Rosling, Filipa Cox, Karelyn Cruz -Martinez, Katarina Ihrmark, Gwen - Aelle Grelet, Björn D. Lindahl, Audrius haimans, Timothy Y. James ( 2011). " Archaeorhizomycetes: Unearthing an ancient class of ubiquitous soil fungi ". Science 333 (6044): 876-9. doi: 10.1126/science.1206958

• Ascomycota
• Ascomycota